LeetCode - Repeated DNA Sequences

Question Definition

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: “ACGAATTCCG”. When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

Java Solution

public List<String> findRepeatedDnaSequences(String s) {
    Set seen = new HashSet(), repeated = new HashSet();
    for (int i = 0; i + 9 < s.length(); i++) {
        String ten = s.substring(i, i + 10);
        if (!seen.add(ten))
            repeated.add(ten);
    }
    return new ArrayList(repeated);
}

LeetCode - H-Index

Question Definition

Given an array of citations (each citation is a non-negative integer) of a researcher, write a function to compute the researcher’s h-index.

According to the definition of h-index on Wikipedia: “A scientist has index h if h of his/her N papers have at least h citations each, and the other N − h papers have no more than h citations each.”

More …